View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15707_low_20 (Length: 239)
Name: NF15707_low_20
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15707_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 35603795 - 35604028
Alignment:
| Q |
1 |
attggcccattgtgaacatccattaaaaatgacatgatattctacagtagagatatacatcatcattgaaaagacccactgataaaa------------g |
88 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||| | | |
|
|
| T |
35603795 |
attggtccattgtgaacatc-attaaaaatgacatgatattctacagtagagatacacatcatcatccaaaagacccactgttaacatagacccatctcg |
35603893 |
T |
 |
| Q |
89 |
agacccatctcattcaagatggattgcaagtaagaccaactcatgatgttaaaagctttgaaaatgttgagtttcaaagctacttcctttatttttactt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603894 |
agacccatctcattcaagatggattgcaagtaagaccaactcatgatgttaaaagctttgaaaatgttgagtttcaaagctacttcctttatttttactt |
35603993 |
T |
 |
| Q |
189 |
tatgtttgaaatggatatggtagaggattttaaag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603994 |
tatgtttgaaatggatatggtagaggattttaaag |
35604028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University