View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15707_low_24 (Length: 204)
Name: NF15707_low_24
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15707_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 191
Target Start/End: Complemental strand, 48276767 - 48276583
Alignment:
| Q |
7 |
atattgatgatgaattgaactactatcatgatccaaacctaacaactgatgagggagtgcagtcaacgagccgccgttacctctcagcacttgttcaaca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48276767 |
atattgatgatgaattgaactactatcatgatccacacctaacaactgatcagggagtgccgtcaacgcgccgccgttacctctcagcacttgttcaaca |
48276668 |
T |
|
| Q |
107 |
ccaagttgacagaattgccactttccagtccataacagcccaactgctccatttactggatttatagttctcccaacagcttcat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276667 |
ccaagttgacagaattgccactttccagtccataacagcccaactgctccatttactggatttatagttctcccaacagcttcat |
48276583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University