View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15707_low_8 (Length: 393)
Name: NF15707_low_8
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15707_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 104 - 336
Target Start/End: Original strand, 868283 - 868514
Alignment:
| Q |
104 |
gcatgcatcaatatattcgggggaagctagctcgttgcatatacgaccttgatcaacaactagaatatggaacaatagcatgtcgcacacaaatggagtt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868283 |
gcatgcatcaatatattcgggggaagctagctcgttgcatatacgaccttgatcaacaactagaatatggaacaatagcatgtcgcacacaaatggagtt |
868382 |
T |
 |
| Q |
204 |
gcaacaaacgactcccacaattgatattttgtgtcactgggctcaacgaggcttaaaatttcaaaattgtaggactttgaaatccacaatgccataattt |
303 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
868383 |
gcaacaa-cgactcccacaattgatattttgtgtcactgggctcaacgaggcttaaaatttcaaaattgtaggactttgaaatccacaatgccataattt |
868481 |
T |
 |
| Q |
304 |
tgccaacggtgttagtggattttcgtttagtta |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
868482 |
tgccaacggtgttagtggattttcgtttagtta |
868514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 6 - 44
Target Start/End: Original strand, 868210 - 868248
Alignment:
| Q |
6 |
atggacatcatcacctacatgtttcatctgatccaccaa |
44 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
868210 |
atggacaccatcacctacatgtttcatctgatccaccaa |
868248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University