View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15708_low_1 (Length: 271)
Name: NF15708_low_1
Description: NF15708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15708_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 33 - 262
Target Start/End: Complemental strand, 3747087 - 3746858
Alignment:
| Q |
33 |
gcttctagcttgattttcgttcttaataagcaattataacttgtctaacttgataatagtatgcacaatctgaagtttttgcaatgatgtggaatggtaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3747087 |
gcttctagcttgattttcgttcttaataagcaattataacttgtctaacttgataatagtatgcacaatctgaagtttttgcaatgatgtggaatggtaa |
3746988 |
T |
 |
| Q |
133 |
gcattatgtaggggttgtttgtgtggcagtttttacagcaactgatttgatatagtcgtagcagagagtaaaccggagctgatgggaacatgtttggtta |
232 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3746987 |
gcattatgtaggggtcgtctgtgtggcagtttttacagcaactgatttgatatagtcgtagcagagagtaaaccggagctgatgggaacatgtttggtta |
3746888 |
T |
 |
| Q |
233 |
attggtagtggaggataaaaatatgatgat |
262 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
3746887 |
attggttgtggaggataaaaatatgatgat |
3746858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University