View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15708_low_1 (Length: 271)

Name: NF15708_low_1
Description: NF15708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15708_low_1
NF15708_low_1
[»] chr3 (1 HSPs)
chr3 (33-262)||(3746858-3747087)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 33 - 262
Target Start/End: Complemental strand, 3747087 - 3746858
Alignment:
33 gcttctagcttgattttcgttcttaataagcaattataacttgtctaacttgataatagtatgcacaatctgaagtttttgcaatgatgtggaatggtaa 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3747087 gcttctagcttgattttcgttcttaataagcaattataacttgtctaacttgataatagtatgcacaatctgaagtttttgcaatgatgtggaatggtaa 3746988  T
133 gcattatgtaggggttgtttgtgtggcagtttttacagcaactgatttgatatagtcgtagcagagagtaaaccggagctgatgggaacatgtttggtta 232  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3746987 gcattatgtaggggtcgtctgtgtggcagtttttacagcaactgatttgatatagtcgtagcagagagtaaaccggagctgatgggaacatgtttggtta 3746888  T
233 attggtagtggaggataaaaatatgatgat 262  Q
    |||||| |||||||||||||||||||||||    
3746887 attggttgtggaggataaaaatatgatgat 3746858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University