View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1570_high_9 (Length: 288)
Name: NF1570_high_9
Description: NF1570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1570_high_9 |
 |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 83 - 288
Target Start/End: Complemental strand, 34442 - 34235
Alignment:
| Q |
83 |
cttttcaaaatctattttatagactaaatatttctaacat-gttttctttgtcatttcaataatctcatagaccaccat-cgcccccatcaactaaattt |
180 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34442 |
cttttcaaaatctactttattgactaaatatttctaacattgttttctttgtcatttcaataatctcatagaccaccattcgcccccatcaactaaattt |
34343 |
T |
 |
| Q |
181 |
cttccattgataaaagtcaattgagtggtagcaaccaccatattcataacccgagctaatctcgctgctaacattgttgatattaatttgtataaacaaa |
280 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
34342 |
cttccattgataaaagtcaattgaatggtagcaaccaccatattcataacccgagctaatctcgctgttaacattgttgatattaatctgtataaacaaa |
34243 |
T |
 |
| Q |
281 |
caagaaga |
288 |
Q |
| |
|
|||||||| |
|
|
| T |
34242 |
caagaaga |
34235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 34476 - 34448
Alignment:
| Q |
1 |
cacaagtccacttaattcatttattacta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34476 |
cacaagtccacttaattcatttattacta |
34448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University