View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1570_low_16 (Length: 232)
Name: NF1570_low_16
Description: NF1570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1570_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 50017049 - 50016837
Alignment:
| Q |
12 |
tggtgtactgtctacaagttttagtgtatttttagttatacaatacaatagacgtgttgaaattaagatgagccacctttggcagcaaacatccacttct |
111 |
Q |
| |
|
||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
50017049 |
tggtggactgtctataggttttagtgtatttttagttatacaatacaatagacgtgttgaaattaagatgagccacctttggtagcaaacatccactcct |
50016950 |
T |
|
| Q |
112 |
gttacaatcatattattacttcttgttagcaatcataccctgaaattgtttgccagtatttaggctacaatctacaaaagttcccataacatcgttccaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50016949 |
gttacaatcatattattacttcttgttagcaatcataccctgaaattgtttgccagtatttaggctacaatctacaaaagttcccataacatcgttccaa |
50016850 |
T |
|
| Q |
212 |
tggtagtttcaac |
224 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
50016849 |
tggtagattcaac |
50016837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University