View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1570_low_17 (Length: 231)
Name: NF1570_low_17
Description: NF1570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1570_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 217
Target Start/End: Original strand, 34830201 - 34830410
Alignment:
| Q |
8 |
taagaatgtcttatagattatattaaattctattttaactgaaggatatttacaggacacagacactagtcattattagtattttttgatnnnnnnngac |
107 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34830201 |
taagaatgtccgataaattatgttaaattctattttaactgaaggatatttacaggacacagacactagtcattattagtattttttgataaaaaaagac |
34830300 |
T |
 |
| Q |
108 |
actactcattattatattctcatttaataattttgttttgctacaaaaatattgtgcacacattaattaatggggtagggtgagttgtatagtaagacgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34830301 |
actactcattattatattctcatttaataattttgttttgctacaaaaatattgtgcacacattaattaatggggtagggtgagttgtatagtaagacgg |
34830400 |
T |
 |
| Q |
208 |
atgaagtaag |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
34830401 |
atgaagtaag |
34830410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University