View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15711_high_5 (Length: 244)
Name: NF15711_high_5
Description: NF15711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15711_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 7909869 - 7909663
Alignment:
| Q |
1 |
tcagccctacatcaccacccatccaaaaccacttctttgggtttaattaattaattgttaaaaacaaaaacgatattctcattgattttt-atttaaaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
7909869 |
tcagccctacatcaccacccatccaaaaccacttctttgggtttaattaattaattgttaaaaacagaaacgatattctcattgatttttaatttaaaaa |
7909770 |
T |
 |
| Q |
100 |
ggaaacaactattttggtctaaaacgtgtgcatttctt--------atctttgaatgtatcaaaatttatcttagatatcatttttgttaataattcata |
191 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| ||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7909769 |
ggaaacaactattttggtctgaaacgtgtgaattactttcattataatctttgaatgtatcaaaatttatcttagataccatttttgttaataattcata |
7909670 |
T |
 |
| Q |
192 |
aactaaa |
198 |
Q |
| |
|
||||||| |
|
|
| T |
7909669 |
aactaaa |
7909663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University