View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_high_14 (Length: 401)
Name: NF15712_high_14
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 75 - 385
Target Start/End: Original strand, 33259358 - 33259676
Alignment:
| Q |
75 |
aaggtaagctagaggtttagaatgggacagat------agatgatgatgtgagactcatatgttttgaaggtggtgttattggacatggatgagtctaaa |
168 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33259358 |
aaggtaagctagaggtttagaatgggacatatcttaatagatgatgatgcgagacttatatgttttgaaggtggtgttattggacatggatgagtctaaa |
33259457 |
T |
|
| Q |
169 |
aatccaccctaaaacatatactacgttctatattttccatgaataaattaggacaagttttcaatggaccggtgaaaaaccattgctaagtagtatcatc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33259458 |
aatccaccctaaaacatatactacgttctatatttcccatgaataaattaggacaagatttgaatggaccggtgaaaaaccattgctaagtagtatcatc |
33259557 |
T |
|
| Q |
269 |
aattaagcaaacaatttgcaagcaaacaa--taacaaagattctctcaactgatattccaacctcttttgatcatgttttgaatcttgaattattggaat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33259558 |
aattaagcaaacaatttgcaagcaaacaaactaacaaagattctctcaactgatattccaacctcttttgatcatgttttgaatcttgaattattggaat |
33259657 |
T |
|
| Q |
367 |
ccatagctgccccacaagg |
385 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33259658 |
ccatagctgccccacaagg |
33259676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 12923876 - 12923933
Alignment:
| Q |
19 |
atatagccctttcccatggtgggaaagaaaattccattcccaggctaaacttaaccaa |
76 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12923876 |
atatggccctttcccatggtgggaaagaaaattccattcccaggctaaacttaaccaa |
12923933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 24 - 74
Target Start/End: Complemental strand, 12912162 - 12912112
Alignment:
| Q |
24 |
gccctttcccatggtgggaaagaaaattccattcccaggctaaacttaacc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12912162 |
gccctttcccatggtgggaaagaaaattccattcccaggctaaacttaacc |
12912112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 27 - 67
Target Start/End: Original strand, 40375255 - 40375295
Alignment:
| Q |
27 |
ctttcccatggtgggaaagaaaattccattcccaggctaaa |
67 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40375255 |
ctttcccatggtgggaaagaagtatccattcccaggctaaa |
40375295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University