View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_high_16 (Length: 388)
Name: NF15712_high_16
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_high_16 |
 | |
|
| [»] scaffold0011 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 64 - 302
Target Start/End: Complemental strand, 190845 - 190607
Alignment:
| Q |
64 |
cattataatactttgtccaaaggatgcctttgcatcccaattgattatgatagaaaatttgagggacacactcatgataaaatatggcaagatcttgtgt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
190845 |
cattataatactttgtccaaaggatgccattgcatcccaattgattatgatagaaaatttgagggacacactcatgataaaatatggcaagatcttgtgt |
190746 |
T |
|
| Q |
164 |
gtgtttctaatttatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagacagtagaggaattgaattacgtacg |
263 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
190745 |
gtgtttctaattcatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagacggtagaggaattgaattgcgtaca |
190646 |
T |
|
| Q |
264 |
attggaatttaattcagttgacagacagcaccgttggcg |
302 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
190645 |
attggaatttaattcatttgacagacagcaccgttggcg |
190607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 41 - 256
Target Start/End: Complemental strand, 219082 - 218867
Alignment:
| Q |
41 |
atatatatagatctgaggatggacattataatactttgtccaaaggatgcctttgcatcccaattgattatgatagaaaatttgagggacacactcatga |
140 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
219082 |
atatacatagatctgaggaaggacattataatactttgtccaaaggatgccattgcatcccaattgattatgatagaaaatttgagggacacactcatga |
218983 |
T |
|
| Q |
141 |
taaaatatggcaagatcttgtgtgtgtttctaatttatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagaca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
218982 |
taaaatatggcaagatcttgtgtgtgtttctaattcatatggtacccattgcaattgccatccctatttatggtgtttggggaccgtacccagcgagacg |
218883 |
T |
|
| Q |
241 |
gtagaggaattgaatt |
256 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
218882 |
gtagaggaattgaatt |
218867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 317 - 350
Target Start/End: Complemental strand, 190579 - 190546
Alignment:
| Q |
317 |
tctcattctaccttgtttgaaggagcaatgatga |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
190579 |
tctcattctaccttgtttgaaggagcaatgatga |
190546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University