View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_high_18 (Length: 366)
Name: NF15712_high_18
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Complemental strand, 46213158 - 46212812
Alignment:
| Q |
1 |
actcaagaggaaacaggttgttaaaatgcaactcattttttcaattagagtgatttgatacttagccatgtatacaagcaagggaagatggagactatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213158 |
actcaagaggaaacaggttgttaaaatgcaactcattttttcaattagagtgatttgatacttagccatgtatacaagcaagggaagatggagactatga |
46213059 |
T |
 |
| Q |
101 |
tttttgaagcattggttataaaatgaaatggataggagaagaaaatttaattataagggtttatgctctattctgagtgagatagatatatttaagactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
46213058 |
tttttgaagcattggttataaaatgaaatggataggagaagaaaatttaattataagggtttatgctctattctaagtgagatagatatatttaagac-t |
46212960 |
T |
 |
| Q |
201 |
taagagaaaggatagtagtgagtgagtgatatttagtgtgccagcagtgcaatggaaatataaaggtgaacggttgattcttgttgaattggtaaattga |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46212959 |
taagagagaggatagtagtgagtgagtgatatttagtgtgccagcagtgcaatggaaatataaaggtgaacggttgattcttgttgaattggtaaattga |
46212860 |
T |
 |
| Q |
301 |
agggtgaattaaaagagctacctatagaggttggtgattgaagttaat |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46212859 |
agggtgaattaaaagagctacctatagaggttggtgattgaagttaat |
46212812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University