View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_high_26 (Length: 285)
Name: NF15712_high_26
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 29 - 269
Target Start/End: Complemental strand, 44012935 - 44012695
Alignment:
| Q |
29 |
atagtgttagaatcaatattatcatttgctgatgtgccaaaaaagagaaaattttcttaccaagaggataagaacactttatcctacctttttaccctac |
128 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44012935 |
atagtgttagaatctatattatcatttgctgatgtgccaaaaaagagaaaattttcttaccaagaggataaaaacactttatcctacctttttaccctac |
44012836 |
T |
 |
| Q |
129 |
ccctacccagcaattccctcagtcgtacacaacacgatcatgacacacacaatgagatgcttccaagaagcctctcaacttggcctcaactcaaatggta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44012835 |
ccctacccagcaattccctcagtcgtacacaacacgatcatgacacacacaatgagatgcttccaagaagcctctcaacttggcctcaactcaaatggta |
44012736 |
T |
 |
| Q |
229 |
ctcgatcctcttggtttatatccctctacccaacaattatc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44012735 |
ctcgatcctcttggtttatatccctctacccaacaattatc |
44012695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University