View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_high_40 (Length: 230)
Name: NF15712_high_40
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 182
Target Start/End: Original strand, 39117755 - 39117923
Alignment:
| Q |
12 |
aagaaaattgggaagaaaattgctctttatgnnnnnnntcattgccattctgaatgaata-taataaataaattcaaataatacccaccattatccattt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||| ||||| || ||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39117755 |
aagacaattgggaagaaaattgctctttatgccccccctcattgcctttctg--tgtataataataaataaattcaaataatacc-accattatccattt |
39117851 |
T |
 |
| Q |
111 |
aattgcacatgtaaaatgagtaacgcgattcgttcaagcgcttttcaggttcgctttctcactatgtttatt |
182 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39117852 |
aattgcacatgtaaaatgagaaacgcgattcgttcaagcgcttttcaggttcgctttctcactatgtttatt |
39117923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University