View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_high_43 (Length: 215)
Name: NF15712_high_43
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 21 - 201
Target Start/End: Complemental strand, 43513640 - 43513460
Alignment:
| Q |
21 |
ttagagacattgatttcaatcaccagcgatgaagatctgaaaaatataattgaagaatacgatcgcgcttcttcatcattaattcatccattgaagatca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43513640 |
ttagagacattgatttcaatcaccagcgatgaagatctgaaaaatataattgaagaatacgatcgagcttcttcatcattaattcatccattgaagatca |
43513541 |
T |
|
| Q |
121 |
gagccattctttcaccgcccaaatcattcaagaaattatctcctcctccgtcttcttcgtccagctcaactcactctctgc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513540 |
gagccattctttcaccgcccaaatcattcaagaaattatctcctcctccgtcttcttcgtccagctcaactcactctctgc |
43513460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University