View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15712_low_37 (Length: 250)
Name: NF15712_low_37
Description: NF15712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15712_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 44012994 - 44013232
Alignment:
| Q |
1 |
ctaacgcatccttactcacgcccaacattttttgggtttgatgggtgatccttgaatccgacaaactctgatgtcatgttaaaaattgtgatttgatcta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
44012994 |
ctaacgcatccttactcacgcccaatattttttgggtttgataggtgatccttgaatccgacaaactctgatgtcatgttaaaaattgtggtttggtcta |
44013093 |
T |
 |
| Q |
101 |
acaaaactgactt-taagttgatgagtgtttcttatatataaactcttatcacgagtcttatctaacttaggtcttg--ttatttccggtaaaatgatca |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
44013094 |
acaaaactgacttgtaagttgatgagtgtttcttatatataaactcttatcgcgaattttatctaacttagatcttgagttatttatggtaaaatgatcg |
44013193 |
T |
 |
| Q |
198 |
ctaataatgtcaattcatattaggcattatgtcccagtttctt |
240 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44013194 |
ctaatg----caattcatattaggcattatgtcccagtttctt |
44013232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University