View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15713_high_7 (Length: 298)
Name: NF15713_high_7
Description: NF15713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15713_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 29332886 - 29332606
Alignment:
| Q |
1 |
atttagttacgttggatgatgatggaaagatctttgcgggggtacatcgtgaagtgttttggtgcatgattcgtgcagtggagatagaagctgcgagcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332886 |
atttagttacgttggatgatgatggaaagatctttgcgggggtacatcgtgaagtgttttggtgcatgattcgtgcagtggagatagaagctgcgagcga |
29332787 |
T |
|
| Q |
101 |
agaggtgatgtgtgaggcgatagttgttatcaaggagtttgatacggtggatgtggagacgatggaaagtgtgattgggaatctttctctggaggaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332786 |
agaggtgatgtgtgaggcgatagttgttatcaaggagtttgatacggtggatgtggagacgatggaaagtgtgattgggaatctttctctggaggaagtg |
29332687 |
T |
|
| Q |
201 |
aagagggtatttgcggttgctatgaagatgctgtcgtgtgttattgatgatcctctttggtatgatgtggatgataagaat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332686 |
aagagggtatttgcggttgctatgaagatgctatcgtgtgttattgatgatcctctttggtatgatgtggatgataagaat |
29332606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 180 - 281
Target Start/End: Complemental strand, 29321516 - 29321415
Alignment:
| Q |
180 |
aatctttctctggaggaagtgaagagggtatttgcggttgctatgaagatgctgtcgtgtgttattgatgatcctctttggtatgatgtggatgataaga |
279 |
Q |
| |
|
|||||||||| |||||||||| |||||| || |||||||| |||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29321516 |
aatctttctcatgaggaagtgagaagggtagttacggttgctgtgaacatgttgtcgtgtgttattgatgatcctctttggtatgatgttgatgataaga |
29321417 |
T |
|
| Q |
280 |
at |
281 |
Q |
| |
|
|| |
|
|
| T |
29321416 |
at |
29321415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 180 - 271
Target Start/End: Complemental strand, 29304348 - 29304257
Alignment:
| Q |
180 |
aatctttctctggaggaagtgaagagggtatttgcggttgctatgaagatgctgtcgtgtgttattgatgatcctctttggtatgatgtgga |
271 |
Q |
| |
|
|||||||||| |||||| ||||||| || ||| ||||| || || ||| |||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
29304348 |
aatctttctcgtgaggaattgaagagagtccttgtagttgccataaacatgttgtcgtgtattgttgatgatcctctttggtatgatgtgga |
29304257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 100
Target Start/End: Complemental strand, 29304466 - 29304410
Alignment:
| Q |
44 |
acatcgtgaagtgttttggtgcatgattcgtgcagtggagatagaagctgcgagcga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | || |||| |||||| || |||||| |
|
|
| T |
29304466 |
acatggtgaagtgttttggtgcatgattcgagtagcggaggtagaagatgtgagcga |
29304410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University