View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15713_low_14 (Length: 258)
Name: NF15713_low_14
Description: NF15713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15713_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 45097287 - 45097054
Alignment:
| Q |
1 |
ttaggcccctcgcagtttgtggtggcattttctgaaattgcaattcttagtttttaggtccttttaatttgcctgcaatttagggatctcaaatgttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45097287 |
ttaggcccctcgcagtttgtggtggcattttctgaaattgcaattcttagtttttaggtcctttt-----gcctgcaatttagggatctcaaatgttctt |
45097193 |
T |
 |
| Q |
101 |
aatactgaactcattggtgctacaaatgcagcataaagtgctcatgagaaatatgcttgttttcttggctttcaagtcttctaaggttgtcccttggccg |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45097192 |
aatactgaactcattggtgctacgaatgcagcatagagtgctcatgagaaatatgcttgttttcttggctttcaagtcttctaaggttgtcccgtggccg |
45097093 |
T |
 |
| Q |
201 |
ttgattgaagaacagatgagagaattgtctctatttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45097092 |
ttgattgaagaacagatgagagaattgtctctatttcat |
45097054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 11775932 - 11775891
Alignment:
| Q |
157 |
ttgttttcttggctttcaagtcttctaaggttgtcccttggc |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11775932 |
ttgttttcttagctttcaagtcttctaaggttgtcccttggc |
11775891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University