View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15713_low_9 (Length: 417)
Name: NF15713_low_9
Description: NF15713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15713_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 25527614 - 25527819
Alignment:
| Q |
16 |
atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25527614 |
atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgattcgttgctgagaacgccgactgg |
25527713 |
T |
|
| Q |
116 |
cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25527714 |
cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctgaggctccgccgttgctg |
25527813 |
T |
|
| Q |
216 |
cttgtt |
221 |
Q |
| |
|
|||||| |
|
|
| T |
25527814 |
cttgtt |
25527819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 25535643 - 25535841
Alignment:
| Q |
16 |
atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg |
115 |
Q |
| |
|
|||||||||||| |||| |||||| || |||||||| ||| | ||||| || |||||||||||||| || |||||||| ||||||||||||| ||||||| |
|
|
| T |
25535643 |
atcaagagcttcattgtatcttttcgcacggtgcattgcagcaatgatagcattgcaggtgaacacagttggacgagttgttgctgagaacgtcgactgg |
25535742 |
T |
|
| Q |
116 |
cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaatgacgtgacacgcgtgtggagttcttcaggaggaggctggggctccgccgttgct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25535743 |
cgggccatggcagaggcagcgtcgaggttgccggagcgaatcaacgatctgacgcgcgtgtggagttcttcaggaggaggctggggctccgccgttgct |
25535841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 16 - 157
Target Start/End: Complemental strand, 25514798 - 25514657
Alignment:
| Q |
16 |
atcaagagcttcgttgtgtctttttgcgcggtgcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg |
115 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25514798 |
atcaagagcttggttgtgtctttttgcgtggagcatggcaccgatgatggcgttgcaggtgaacaccgtcggacgagtcgttgctgagaacgccgactgg |
25514699 |
T |
|
| Q |
116 |
cgggccatggcagaggcagcgtcgaggttgccggagcgaatc |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25514698 |
cgggccatggcagaggcagcgttgaggttgccggagcgaatc |
25514657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 281 - 398
Target Start/End: Original strand, 25527879 - 25527996
Alignment:
| Q |
281 |
tggcgacagagtgacattgttgagtttgaaaccctaaaatttcgtactttctaatttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat |
380 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25527879 |
tggcgaaagagtgacattgttgagtttgaaaccctaaaatttcgtactttctattttgaaatgaaaatgaaatgaattcttctaacatctttcttcttat |
25527978 |
T |
|
| Q |
381 |
atatactacccccagcag |
398 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
25527979 |
atatactaccaccagcag |
25527996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University