View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15714_high_11 (Length: 233)
Name: NF15714_high_11
Description: NF15714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15714_high_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 30922934 - 30923149
Alignment:
| Q |
18 |
aacaacatgtccaaagtagtctgcgtcactggcggcagcggatgcatcggttcatggctcgttcatctccttcttcaccgtggctacaccgttcacgcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30922934 |
aacaacatgtccaaagtagtctgcgtcaccggcggcagcggatgcatcggttcatggctcgttcatctccttctccaccgtggctacatcgttcacgcca |
30923033 |
T |
 |
| Q |
118 |
ccgtccaaaatctcaacgatgagaacgagacgaagcatctacaagctcttgaaggagctcaaactaatctccgtctcttccaaattgacctcctcaacta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923034 |
ccgtccaaaatctcaacgatgagaacgagacgaagcatctacaagctcttgaaggagctcaaactaatctccgtctcttccaaattgacctcctcaacta |
30923133 |
T |
 |
| Q |
218 |
cgacactgtcctcgcc |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30923134 |
cgacactgtcctcgcc |
30923149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University