View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15714_high_8 (Length: 280)
Name: NF15714_high_8
Description: NF15714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15714_high_8 |
 |  |
|
| [»] scaffold0245 (1 HSPs) |
 |  |  |
|
| [»] scaffold0279 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 264
Target Start/End: Complemental strand, 37520695 - 37520442
Alignment:
| Q |
11 |
ggtcggccctatgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggca |
110 |
Q |
| |
|
||||||| | ||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37520695 |
ggtcggcgccatgtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgggcttgggaccggccttggca |
37520596 |
T |
 |
| Q |
111 |
ggattatgttatctcaaataataaggttgattttattaataagggatttagtctaacgaattagcaattgaaaaagaaaacgctaaaccaaactcaaccc |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37520595 |
ggattatgttatctcaaataataaggtagattttattaataagggatttagtctaacaaattagcaattgaaaaagaaaacgctaaaccaaactcaaccc |
37520496 |
T |
 |
| Q |
211 |
atccacattgtaatgtaagctttgtcccaattttgtgtttcttgcccttaactt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37520495 |
atccacattgtaatgtaagctttgtcccaattttgtgtttcttgcccttaactt |
37520442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 21 - 115
Target Start/End: Complemental strand, 1648102 - 1648008
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1648102 |
atgtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgggcttgggaccggccttggcaggatt |
1648008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 115
Target Start/End: Original strand, 8561071 - 8561165
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
8561071 |
atgtcatagggattcaacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccaggcttgggaccggccttggcaggatt |
8561165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 16290837 - 16290742
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16290837 |
atgtcatagagattcgacaaagttttacgttggctatcgaggcctaacacaaccctttccttttacccgggcttgggaccggccttggcaggatta |
16290742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 21 - 108
Target Start/End: Complemental strand, 11993001 - 11992914
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttgg |
108 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11993001 |
atgtcatagagattcgacaaagttttatgttggctgtcgaggcctaacacaaccctcttcttttacccgggcttgggaccggccttgg |
11992914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 22 - 115
Target Start/End: Original strand, 45329643 - 45329736
Alignment:
| Q |
22 |
tgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||| |||||| ||||||||||||||||| |||||| | |||||||| |||||||| ||| |||| |
|
|
| T |
45329643 |
tgtcatagagattcgataaagttttacgttggctgtcgagacctaacacaaccctctccttttactcaggcttggggccggccttagcatgatt |
45329736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 23766906 - 23766962
Alignment:
| Q |
23 |
gtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctc |
79 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
23766906 |
gtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctc |
23766962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 23796099 - 23796155
Alignment:
| Q |
23 |
gtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctc |
79 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
23796099 |
gtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctc |
23796155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 101
Target Start/End: Original strand, 28218521 - 28218585
Alignment:
| Q |
37 |
acaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccg |
101 |
Q |
| |
|
||||| |||||| ||| |||| || |||||||||||||||||| |||||||| | || ||||||| |
|
|
| T |
28218521 |
acaaaattttacgttgaccgttgaagcctaacacaaccctctccttttacccagactagggaccg |
28218585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 16008438 - 16008534
Alignment:
| Q |
19 |
ctatgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
16008438 |
ctatgtcatagagattcaacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccaggcttgggaccggccttggcaggatt |
16008534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 26 - 115
Target Start/End: Complemental strand, 4061898 - 4061809
Alignment:
| Q |
26 |
atagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4061898 |
atagagatttgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgggtttgggaccggccttggcaggatt |
4061809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 121
Target Start/End: Original strand, 15218284 - 15218384
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggattatgtt |
120 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||| | ||||||| ||||||||||||||| ||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
15218284 |
atgtcatagagattcgacaaaattttacgttgactatcgaggcttaacacaaccctctccttttacccgaacttaggaccgaccttggcaggattatgtt |
15218383 |
T |
 |
| Q |
121 |
a |
121 |
Q |
| |
|
| |
|
|
| T |
15218384 |
a |
15218384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 28 - 100
Target Start/End: Complemental strand, 29520578 - 29520506
Alignment:
| Q |
28 |
agagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggacc |
100 |
Q |
| |
|
|||| ||||||| |||||||| |||| || ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29520578 |
agaggttcaacagagttttacgttggttgtagaggcctaacacaaccctctccttttacccgggcttgggacc |
29520506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 24 - 115
Target Start/End: Complemental strand, 3801924 - 3801832
Alignment:
| Q |
24 |
tcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttaccc-gggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||| ||||||||| ||||||| ||| |||| ||||||| ||| || |||| ||||||| |
|
|
| T |
3801924 |
tcatagagattcaacaaagttttacgttggttgtcgagacctaacacagccctctcctttcacccggggcttgagactggtcttgacaggatt |
3801832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 35323967 - 35323871
Alignment:
| Q |
19 |
ctatgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||| |||||||||| || ||||| ||| ||||||| ||||||||||| | |||||| |||||| |
|
|
| T |
35323967 |
ctatgtcatagagattcgacaaaattttaagttggctgtcgaggcctgacccaaccgtcttcttttacctgggcttgggactgaccttggtaggatt |
35323871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 103
Target Start/End: Original strand, 30453894 - 30453935
Alignment:
| Q |
62 |
gcctaacacaaccctctctttttacccgggcttgggaccggc |
103 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30453894 |
gcctaacacaaccctctctttttatccgggcttgggaccggc |
30453935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 35249875 - 35249776
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttgg----ccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||| | ||||||||||| ||||||||||| |||||| ||||||||||||| | |||| |||||||| |
|
|
| T |
35249875 |
atgttatagagattcgacaaagttttatgttggttgtctgtcgaggcctatcacaaccctcttcttttacgcgggcttgggaccagtcttgacaggatta |
35249776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 20430570 - 20430665
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20430570 |
atgtcatagagattcaacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgagcttgggaccggccttggcaggatta |
20430665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 6079669 - 6079585
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggcct |
105 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6079669 |
atgtcatagagattcgacaaagttttacgttgactgtcgaggcctaacgcaaccctctccttttacccgggcttgggaccggcct |
6079585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 2078541 - 2078637
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggattat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2078541 |
atgtcatagagattcgacaaagttttactttggctgtcgaggcctaacacaaccctctccttttatccgggcttgggaccggccttggcaggattat |
2078637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 21 - 103
Target Start/End: Original strand, 39668782 - 39668864
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggc |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| ||||||| |||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39668782 |
atgtcatagagattcgacaaagttttacgttggctgtcgaggactaacacaaccctcaccttttacccgggcttgggaccggc |
39668864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 10293688 - 10293773
Alignment:
| Q |
31 |
gattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
||||| |||||||||||| ||| |||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10293688 |
gattcgacaaagttttacgttgcatgtcgaggcctaacacaaccctctccttttacccgagtttgggaccggccttggcaggatta |
10293773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 21 - 107
Target Start/End: Complemental strand, 32489195 - 32489109
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttg |
107 |
Q |
| |
|
||||||||| ||||| |||||||||||| ||| | ||||||| |||||||||||||||| |||||| || |||||| |||||||||| |
|
|
| T |
32489195 |
atgtcatagggattcgacaaagttttacgttgactgtcgaggtctaacacaaccctctccttttactcgagcttggaaccggccttg |
32489109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 97
Target Start/End: Original strand, 11069366 - 11069442
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttggg |
97 |
Q |
| |
|
||||||||||||||| |||||||||| | |||| || ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11069366 |
atgtcatagagattcgacaaagttttgcgttggttgttgaggcctaacacaacgctctccttttacccgggcttggg |
11069442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 82
Target Start/End: Complemental strand, 3292724 - 3292663
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctcttt |
82 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
3292724 |
atgtcatagtgattcgacaaagttttatgttggctgttgaggcctaacacaaccctctcttt |
3292663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 112
Target Start/End: Complemental strand, 25213 - 25160
Alignment:
| Q |
59 |
gaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcagg |
112 |
Q |
| |
|
||||||| |||||| ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
25213 |
gaggcctgacacaattctctccttttacccggatttgggaccggccttggcagg |
25160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 22703828 - 22703892
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctcttttta |
85 |
Q |
| |
|
|||| ||||| |||| |||||||||| ||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
22703828 |
atgttatagaaattcgacaaagttttgtgttggctgtcgaggtctaacacaaccctctcctttta |
22703892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 17)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 32079399 - 32079304
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32079399 |
atgtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgggcttgagaccggccttggcaggatta |
32079304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 49350474 - 49350569
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49350474 |
atgtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacctgggcttgggaccggccttggcaggatta |
49350569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 21 - 113
Target Start/End: Original strand, 49527438 - 49527530
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
49527438 |
atgtcatagagattcaacaaagttttacgttggctgtcgaggcctaacacaatcctctccttttacccgagcttgggaccggccttggcagga |
49527530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 52921073 - 52920977
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggattat |
117 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52921073 |
atgtcatagagattcgacaaagttttatgttggctgtcaaggcctaacacaaccctctccttttacccgggcttgggaccggccttggcaggattat |
52920977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 21 - 111
Target Start/End: Complemental strand, 4001940 - 4001850
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcag |
111 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
4001940 |
atgtcatagagattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgggcttggggccggccttggcag |
4001850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 113
Target Start/End: Original strand, 1290193 - 1290285
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcagga |
113 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||| ||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1290193 |
atgtcatagagattctaaaaagttttacgttggctgtcaaggcctgacacaaccctctttttttacccgggcttgggaccggccttggcagga |
1290285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 22 - 108
Target Start/End: Complemental strand, 9600001 - 9599915
Alignment:
| Q |
22 |
tgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttgg |
108 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
9600001 |
tgtcatagagatccgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgagcttgggacccgccttgg |
9599915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 21 - 115
Target Start/End: Complemental strand, 51850855 - 51850761
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||||||||| || |||||||| |||| |||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
51850855 |
atgtcatagagattcgacgaagttttatgttggatgtcgaggcctaacacaaccctctccttttacccaggcttgggactggccttggcaggatt |
51850761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 21 - 92
Target Start/End: Original strand, 8670808 - 8670879
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggc |
92 |
Q |
| |
|
|||| |||||||||| |||||||||||| ||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8670808 |
atgttatagagattcgacaaagttttacattggctgtcgaggcctaacacaaccctctccttttacccgggc |
8670879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 25 - 105
Target Start/End: Complemental strand, 52815098 - 52815018
Alignment:
| Q |
25 |
catagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggcct |
105 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||| |||||||||||||||||||| ||||||||| | ||||||||||||| |
|
|
| T |
52815098 |
catagagagtcaacaaagttttacgttggttgtcaaggcctaacacaaccctctccttttacccgagtttgggaccggcct |
52815018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 21 - 103
Target Start/End: Original strand, 6985616 - 6985696
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggc |
103 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| |||| |||||||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
6985616 |
atgtcatagagattcgacaaagttttacgttggctgtcg--gcctaacacaaccctctcctttcatccgggcttgggaccggc |
6985696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 89
Target Start/End: Complemental strand, 6039680 - 6039612
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || ||||||||| |||||| |||| ||||||||| |
|
|
| T |
6039680 |
atgtcatagagattcaacaaagttttacgttggctgttgaggcctaatacaaccttctccttttacccg |
6039612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 52463090 - 52463154
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctcttttta |
85 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
52463090 |
atgtcatagagattcgacaaagttttaagttggcagtcgaggtctaacacaaccctctcctttta |
52463154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 115
Target Start/End: Original strand, 15424512 - 15424604
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
|||| ||||||||| |||||||||||| |||| |||| |||||||||||| |||||| ||||| || ||||||||||||||||||| |||||| |
|
|
| T |
15424512 |
atgttatagagatttgacaaagttttacgttggttgtcgtggcctaacacaa-cctctccttttatcc-ggcttgggaccggccttggtaggatt |
15424604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 117
Target Start/End: Original strand, 16538789 - 16538850
Alignment:
| Q |
56 |
gtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggattat |
117 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
16538789 |
gtcgaggtctaacacaaccatctccttttaccagagcttgggaccgaccttggcaggattat |
16538850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 14732397 - 14732466
Alignment:
| Q |
31 |
gattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccg |
101 |
Q |
| |
|
||||||||||||| |||| ||| | | ||||| ||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
14732397 |
gattcaacaaagtattacgttgactgccgaggtctaacacaaccctctctgttta-ccgggcttgagaccg |
14732466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 117
Target Start/End: Original strand, 51444589 - 51444631
Alignment:
| Q |
75 |
ctctctttttacccgggcttgggaccggccttggcaggattat |
117 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
51444589 |
ctctccttttacccgtgcttgggaccggctttggcaggattat |
51444631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 123
Target Start/End: Original strand, 31566262 - 31566364
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggattatgtt |
120 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
31566262 |
atgtcatagagattctacaaagttctacgttggctgtcgaggcctaacacaaccctctccttttacccgggcttgggaccggctttggcaggattaggtt |
31566361 |
T |
 |
| Q |
121 |
atc |
123 |
Q |
| |
|
||| |
|
|
| T |
31566362 |
atc |
31566364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 52136411 - 52136315
Alignment:
| Q |
19 |
ctatgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52136411 |
ctatgtcatagagattcgacaaagttttacgttggctatcaaggcctaacacaaccctctccttttacccgggcttgggaccggccttggcaggatt |
52136315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 25 - 115
Target Start/End: Original strand, 51450771 - 51450861
Alignment:
| Q |
25 |
catagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
|||||| |||| |||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51450771 |
catagatattcgacaaagttttacgttggctgtcgaggcctaacacaaccctctccttttacccgggcttgggaccggccttggcaggatt |
51450861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 7023241 - 7023146
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||| || ||||||||||||||||||||| ||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
7023241 |
atgtcatagagatttgataaagttttacgttggctgttgaggcctaacacaaccctctccttttacctgggcttgggaccgaccttagcaggatta |
7023146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 107
Target Start/End: Complemental strand, 9256355 - 9256267
Alignment:
| Q |
19 |
ctatgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttg |
107 |
Q |
| |
|
||||| ||||||||||| ||||| |||||| ||||| || ||||||||||||||||||||| ||||||||| |||| || ||||||||| |
|
|
| T |
9256355 |
ctatgccatagagattcgacaaaattttacgttggctgttgaggcctaacacaaccctctccttttacccgagcttagggccggccttg |
9256267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 99
Target Start/End: Original strand, 27215624 - 27215702
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggac |
99 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| | ||||||| ||||||||||| | |||||||||| |||||||| |
|
|
| T |
27215624 |
atgtcatagagatacaacaaagttttacgttgcttattgaggcctgacacaaccctcaccttttacccggacttgggac |
27215702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0245 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0245
Description:
Target: scaffold0245; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 113
Target Start/End: Original strand, 16598 - 16690
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcagga |
113 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||| ||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16598 |
atgtcatagagattctaaaaagttttacgttggctgtcaaggcctgacacaaccctctttttttacccgggcttgggaccggccttggcagga |
16690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0279 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0279
Description:
Target: scaffold0279; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 21 - 115
Target Start/End: Complemental strand, 18477 - 18383
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| |||||||| |||||||||| |||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18477 |
atgtcatagagattcgacaaagttttacgttggttgtcgaggcttaacacaaccttctccttttacccgggcttgggaccggctttggcaggatt |
18383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 48260 - 48350
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcag |
111 |
Q |
| |
|
||||||||||||||| | |||||| || ||||| ||||||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
48260 |
atgtcatagagattcgataaagttatatgttggctgtcgaggcctaacgaaaccctctccttttacccggacttgggaccggccttggcag |
48350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 22 - 103
Target Start/End: Complemental strand, 54529636 - 54529556
Alignment:
| Q |
22 |
tgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggc |
103 |
Q |
| |
|
|||||||| ||||| ||||||| |||| ||||| ||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
54529636 |
tgtcatag-gattcgacaaagtgttacgttggctgtcgaggcctaacacaaccctctctttttacccagccttgggaccggc |
54529556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 16000320 - 16000228
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggattat |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| | |||||| |||||||||||||| |||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
16000320 |
atgtcatagagactcaacaaagttttacgttgactgtcgag----aacacaaccctctccttttacccggacttgggaccggtcttggtaggattat |
16000228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 27453167 - 27453260
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||| |||||||| ||||| |||| || |||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
27453167 |
atgtcatagagattcggcaaagttttacgttggctgtcgaggcataacataacc--ttccttttactcgggcttgggatcgaccttggtaggatta |
27453260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 38475067 - 38475124
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctct |
78 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||| | |||||||||||||| ||||| |
|
|
| T |
38475067 |
atgtcatagagattcgacaacgttttacgttggctattgaggcctaacacaagcctct |
38475124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 116
Target Start/End: Original strand, 883570 - 883626
Alignment:
| Q |
60 |
aggcctaacacaaccctctctttttacccgggcttgggaccggccttggcaggatta |
116 |
Q |
| |
|
|||||||||||||| |||| ||||||| | |||||| |||| |||||||||||||| |
|
|
| T |
883570 |
aggcctaacacaactctctgcttttacctgagcttggaaccgaccttggcaggatta |
883626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 99
Target Start/End: Original strand, 42309152 - 42309192
Alignment:
| Q |
59 |
gaggcctaacacaaccctctctttttacccgggcttgggac |
99 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||||||||| |
|
|
| T |
42309152 |
gaggcctaacacaaccctatccttttatccgggcttgggac |
42309192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 440178 - 440120
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctc |
79 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
440178 |
atgtcatagagatttgacaaagttttacgttggctgtcgaggcctaacacaatcctctc |
440120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 84
Target Start/End: Original strand, 46833168 - 46833228
Alignment:
| Q |
21 |
atgtcatagagattcaacaaagttttaccttggccgtcgaggcctaacacaaccctctcttttt |
84 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| || ||||||||||||||||||||| |||| |
|
|
| T |
46833168 |
atgtcatagagattcgacaaagttttacgttg---gttgaggcctaacacaaccctctcctttt |
46833228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 36232159 - 36232115
Alignment:
| Q |
30 |
agattcaacaaagttttaccttggccgtcgaggcctaacacaacc |
74 |
Q |
| |
|
|||||| ||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36232159 |
agattcgacaaagttttatgttggctgtcgaggcctaacacaacc |
36232115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University