View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15714_low_12 (Length: 322)
Name: NF15714_low_12
Description: NF15714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15714_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 96 - 298
Target Start/End: Complemental strand, 5174114 - 5173912
Alignment:
| Q |
96 |
aaaacactacacaacatatattaatttcataacaatacagcttgtctcctttgtaaaacctttaactttgtgtcgatatcaacaatacggcctgcaattg |
195 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174114 |
aaaacactacataacatatattaatttcataacaatacagcttgtctcctttgtaaaacctttaactttgtgtcgatatcaacaatacggcctgcaattg |
5174015 |
T |
 |
| Q |
196 |
tgacattctaatatatatactcacaaaaataaattatgtgcatacactccaaaaacacttgaatgaaatgactcgggtctcttacaacataacataggtc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174014 |
tgacattctaatatatatactcacaaaattaaattatgtgcatacactccaaaaacacttgaatgaaatgactcgggtctcttacaacataacataggtc |
5173915 |
T |
 |
| Q |
296 |
cta |
298 |
Q |
| |
|
||| |
|
|
| T |
5173914 |
cta |
5173912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University