View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15714_low_9 (Length: 362)
Name: NF15714_low_9
Description: NF15714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15714_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 118 - 315
Target Start/End: Complemental strand, 28691830 - 28691642
Alignment:
| Q |
118 |
gaacctgtggcctatttaggtatgctgcagtataatctgatgcacatggatcatatcctgctagatttttatgccacccgtcctattaaaatcgacaatt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28691830 |
gaacctctggcctatttaggtatgctgcagtataatctgatgcacatggatcatatcctgctagatttttatgccacccgtcctattaaaattgacaatt |
28691731 |
T |
 |
| Q |
218 |
tcaataggcaagtaactttagttgctgtagtatacgtgtactagtttttaagttctaaattgatgaattaactcaccagtaccaatttggaaaaagaa |
315 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28691730 |
tcaataggcaagtaacgttagttgcagta------gtgtactagtttttaagttctaaattgatga---aactcaccagtaccaatttggaaaaagaa |
28691642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 8682744 - 8682843
Alignment:
| Q |
18 |
gtgatgacaacaaaacggccaatgaaggcggtggtaaaaatgcaggtggtggcacaaaagtagaggaagtgaagccagcaccacagccagtgaacgagca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8682744 |
gtgatgacaacaaaacggccaatgaaggcggtggtaaaaatgcaggtggtggctcaaaagtagaggaagtgaagccagcaccacagccagtgaaagagca |
8682843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University