View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15715_low_12 (Length: 400)
Name: NF15715_low_12
Description: NF15715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15715_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 12 - 151
Target Start/End: Complemental strand, 38367612 - 38367473
Alignment:
| Q |
12 |
aagaaatgatccccacacacgtatatgattgtaccacatgaattgataaatcatgtgcaacagatttgtgatggctcaaacctcaaggtgtacggagtac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367612 |
aagaaatgatccccacacacgtatatgattgtaccacatgaattgataaatcatgtgcaacagatttgtgatggctcaaacctcaaggtgtacggagtac |
38367513 |
T |
 |
| Q |
112 |
tggatccagtttactatacactttaacgatctttgccttt |
151 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38367512 |
tggattcagtttactatacactttaacgatctttgccttt |
38367473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 180 - 311
Target Start/End: Complemental strand, 38367428 - 38367301
Alignment:
| Q |
180 |
tttgtttaatttaattattttgaagcataaactaaagatcctgaagtttactaaaattgattatcagatcttgggagtacagtgaatgtagagaaaagag |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367428 |
tttgtttaatttaattattttgaagcataaactaaagatcctgaagtttactaaaattgattatcagatcttgggagtacagtgaatgtagagaaaagag |
38367329 |
T |
 |
| Q |
280 |
aaacatgcatgcatggttttgttttgacttaa |
311 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
38367328 |
aaacatg----catggttttgttttgacttaa |
38367301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 338 - 385
Target Start/End: Complemental strand, 38367269 - 38367222
Alignment:
| Q |
338 |
gttaacctacttgggggatttaagtacactttttaaccactctatttt |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38367269 |
gttaacctacttgggggatttaagtacactttttaaccactctatttt |
38367222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University