View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15715_low_27 (Length: 234)

Name: NF15715_low_27
Description: NF15715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15715_low_27
NF15715_low_27
[»] chr4 (1 HSPs)
chr4 (15-234)||(40774591-40774810)


Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 40774591 - 40774810
Alignment:
15 atggtcaacacatattacggttnnnnnnncagtaatttatacacatttttctgttttaaactttcacttaactaattcatattcagagtgttactctcaa 114  Q
    ||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40774591 atggtcaacacatattacggttaaaaaaacagtaatttatacacatttttctgttttaaactttcacttaactaattcatattcagagtgttactctcaa 40774690  T
115 aaagtaggcttgatggtttgtgctagcaaacttgaactgttaattgtgcaaatcagtttacaaacagttcaccatagctgtctttctttatcaacccaac 214  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
40774691 aaagtaggcttgatggtttgtgctagcaaactggaactgttaattgtgcaaatcagtttacaaacagttcaccatagctgtctttctttatcaactcaac 40774790  T
215 ctcaaaaccaaaatgataac 234  Q
    ||||||||||||||||||||    
40774791 ctcaaaaccaaaatgataac 40774810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University