View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15715_low_27 (Length: 234)
Name: NF15715_low_27
Description: NF15715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15715_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 40774591 - 40774810
Alignment:
| Q |
15 |
atggtcaacacatattacggttnnnnnnncagtaatttatacacatttttctgttttaaactttcacttaactaattcatattcagagtgttactctcaa |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40774591 |
atggtcaacacatattacggttaaaaaaacagtaatttatacacatttttctgttttaaactttcacttaactaattcatattcagagtgttactctcaa |
40774690 |
T |
 |
| Q |
115 |
aaagtaggcttgatggtttgtgctagcaaacttgaactgttaattgtgcaaatcagtttacaaacagttcaccatagctgtctttctttatcaacccaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40774691 |
aaagtaggcttgatggtttgtgctagcaaactggaactgttaattgtgcaaatcagtttacaaacagttcaccatagctgtctttctttatcaactcaac |
40774790 |
T |
 |
| Q |
215 |
ctcaaaaccaaaatgataac |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40774791 |
ctcaaaaccaaaatgataac |
40774810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University