View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15716_high_4 (Length: 273)
Name: NF15716_high_4
Description: NF15716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15716_high_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 38 - 273
Target Start/End: Complemental strand, 33989358 - 33989123
Alignment:
| Q |
38 |
aaacaatgactctaaacatcataaatggtaaaagattttgctttaactaaagatgcaataccatagaagatcgcttcttcaagacggattcatgtgtttc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33989358 |
aaacaatgactctaaacatcataaatggtaaaagattttgctttaactaaagatgcaataccatagaagatcgcttcttcaagacggattcatgtgtttc |
33989259 |
T |
 |
| Q |
138 |
cgactcttttattaagctatcatcatcgtcgtcgtcatcacaaggaacatttggttcagaatatagccatccacatgaactttcaccattttgcttctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33989258 |
cgactcttttattaagctatcatcatcatcgtcatcatcacaaggaacatttggttcagagtatagccatccacatgaactttcaccattttgcttctct |
33989159 |
T |
 |
| Q |
238 |
tttacactattgaacatggatccatagctaccactt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33989158 |
tttacactattgaacatggatccatagctaccactt |
33989123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University