View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15716_low_6 (Length: 273)

Name: NF15716_low_6
Description: NF15716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15716_low_6
NF15716_low_6
[»] chr5 (1 HSPs)
chr5 (38-273)||(33989123-33989358)


Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 38 - 273
Target Start/End: Complemental strand, 33989358 - 33989123
Alignment:
38 aaacaatgactctaaacatcataaatggtaaaagattttgctttaactaaagatgcaataccatagaagatcgcttcttcaagacggattcatgtgtttc 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33989358 aaacaatgactctaaacatcataaatggtaaaagattttgctttaactaaagatgcaataccatagaagatcgcttcttcaagacggattcatgtgtttc 33989259  T
138 cgactcttttattaagctatcatcatcgtcgtcgtcatcacaaggaacatttggttcagaatatagccatccacatgaactttcaccattttgcttctct 237  Q
    ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
33989258 cgactcttttattaagctatcatcatcatcgtcatcatcacaaggaacatttggttcagagtatagccatccacatgaactttcaccattttgcttctct 33989159  T
238 tttacactattgaacatggatccatagctaccactt 273  Q
    ||||||||||||||||||||||||||||||||||||    
33989158 tttacactattgaacatggatccatagctaccactt 33989123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University