View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_high_11 (Length: 241)
Name: NF15717_high_11
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 45862450 - 45862667
Alignment:
| Q |
18 |
cagccaaatcaagcaactcagggtaacattcttctataacagctctagattcatcagaaatctctagcttgtagttgaagtcaggtggtggaggtttgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45862450 |
cagccaaatcaagcaactcagggtaacattcttctataacagctctagattcatcagaaatctctagcttgtagttgaagtcaggtggtggaggtttgac |
45862549 |
T |
|
| Q |
118 |
tgaaacctttaagggtctgagagatgtttttgagataaaaaatggattggttgtgaaaatggggaaggttggttttatgatgggggaatacatggaatga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45862550 |
tgaaacctttaagggtctgagagatgtttttgagataaaaaatggattggttgtgaaaatggggaaggttggttttatgatgggggaatacatggaatga |
45862649 |
T |
|
| Q |
218 |
atgattaagatgatgatg |
235 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
45862650 |
atgattaaggtgatgatg |
45862667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University