View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_high_7 (Length: 326)
Name: NF15717_high_7
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_high_7 |
 |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 20 - 311
Target Start/End: Complemental strand, 9083371 - 9083080
Alignment:
| Q |
20 |
aattgtggcgatccgtttttggttttgttttgtaggttgcgggaagggcatttcagattgtgtttaatttaggttcatttggtttgaagctattatggga |
119 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083371 |
aattgtgttgatccgtttttggttttgttgtgtaggttgcgggaagggcatttcagattgtgtttaatttaggttcatttggtttgaagctattatggga |
9083272 |
T |
 |
| Q |
120 |
gcagagaaatggagttgctgatcagaataaaaggattcgtgctattgagcttaggaatatattcactaagcttggaccaacttttgtcaaattgggtcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083271 |
gcagagaaatggagttgctgatcagaataaaaggattcgtgctattgagcttaggaatatattcactaagcttggaccaacttttgtcaaattgggtcaa |
9083172 |
T |
 |
| Q |
220 |
gggctgtctactagacccgatatttgtccatctgagtatcttgaggagctttctgaacttcaagtattgaattcttaccttttggttttctt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9083171 |
gggctgtctactagacccgatatttgtccatctgagtatcttgaggagctttctgaacttcaagtattgaattcttaccttttggttttctt |
9083080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 254
Target Start/End: Original strand, 17246 - 17322
Alignment:
| Q |
178 |
atattcactaagcttggaccaacttttgtcaaattgggtcaagggctgtctactagacccgatatttgtccatctga |
254 |
Q |
| |
|
|||||||| |||| |||||||||||||| || ||||||||||| |||||||||| || || ||||| ||| |||| |
|
|
| T |
17246 |
atattcacacagctaggaccaacttttgtgaagttgggtcaaggattgtctactaggcctgacatttgcccacctga |
17322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University