View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_low_11 (Length: 282)
Name: NF15717_low_11
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 64 - 260
Target Start/End: Original strand, 17472641 - 17472838
Alignment:
| Q |
64 |
acttgcatttcatcattcattttgcttagatcacaaccgatagctttggaacttgcacgtacgtgcactcatgcagttgataagtgtctctttcgcatta |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17472641 |
acttgcatttcatcattcattttgcttagatcacaaccgatagctttggaacttgcacgtacgtgcactcatgcagttgataagtgtctttttcgcatta |
17472740 |
T |
 |
| Q |
164 |
gaatggatc-tcccgccgcttgttttgattatcttttaagctgtatttggtttggaagagagaaataagttggaggggtatttggtaatttcgtggtt |
260 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||| |
|
|
| T |
17472741 |
gaatggatcttcccgccgcttgttttggttatcttttaagctgtatttggtttggaagagagaaataagttggaggagtatttggtattttcctggtt |
17472838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University