View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_low_14 (Length: 245)
Name: NF15717_low_14
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 113 - 148
Target Start/End: Original strand, 7558005 - 7558040
Alignment:
| Q |
113 |
gaggaagtgaaggggaccaaacttaaactcagtgat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7558005 |
gaggaagtgaaggggaccaaacttaaactcagtgat |
7558040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University