View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_low_17 (Length: 240)
Name: NF15717_low_17
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 32004926 - 32004720
Alignment:
| Q |
19 |
gttacttctgttgattttaatcgcgacggttcgcttattgtttcggggagtcatgatgggtcttgtaagatttgggataccaattctggcgcgctgttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32004926 |
gttacttctgttgattttaatcgcgacggttcgcttattgtttctgggagtcatgatgggtcttgtaagatttgggataccaattctggtgcgctgttga |
32004827 |
T |
|
| Q |
119 |
agactttgattgatgataaggttcctgctgtttcgttcgccaaattttcgcctaatgggaaatttatacttgttgctactcttaatgatacacttgtgag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32004826 |
agactttgattgatgataaggttcctgctgtttcgttcgccaaattttcgcctaatgggaaatttatacttgttgctactcttaatgatacacttgtgag |
32004727 |
T |
|
| Q |
219 |
ttctctg |
225 |
Q |
| |
|
||||||| |
|
|
| T |
32004726 |
ttctctg |
32004720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University