View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_low_7 (Length: 340)
Name: NF15717_low_7
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 2170263 - 2170032
Alignment:
| Q |
11 |
caaatggttggtgtgtaatgtgtattactaaatcctagggtactaagttcaattcttgctactcnnnnnnnggttagtgttatgtggttttattatactg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2170263 |
caaatggttggtgtgtaatgtgtattactaaatcctagggtactaagttcaattcttgctactcaaaaaaaggttagtgttatgtggttttattatactg |
2170164 |
T |
|
| Q |
111 |
ggggtattaagcagtagtaatcatcttattatttatttaaagtaagaaggcaagggagaatgaaaagattctgttgtagccaaaatttaccattattagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170163 |
ggggtattaagcagtagtaatcatcttattatttatttaaagtaagaaggcaagggagaatgaaaagattctgttgtagccaaaatttaccattattagt |
2170064 |
T |
|
| Q |
211 |
tgtgaatctgcactgcaaatttgggcttctag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2170063 |
tgtgaatctgcactgcaaatttgggcttctag |
2170032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University