View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15717_low_9 (Length: 306)
Name: NF15717_low_9
Description: NF15717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15717_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 125
Target Start/End: Complemental strand, 43016602 - 43016495
Alignment:
| Q |
18 |
aagaatatttaagaagactaaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016602 |
aagaatatttaagaagactaaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaatt |
43016503 |
T |
|
| Q |
118 |
gtcatcaa |
125 |
Q |
| |
|
|||||||| |
|
|
| T |
43016502 |
gtcatcaa |
43016495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 222
Target Start/End: Complemental strand, 43016433 - 43016398
Alignment:
| Q |
187 |
aggcctacttatatggaaagctgcgtttgcactaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016433 |
aggcctacttatatggaaagctgcgtttgcactaat |
43016398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University