View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_high_20 (Length: 377)
Name: NF15718_high_20
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 151 - 320
Target Start/End: Complemental strand, 13645275 - 13645105
Alignment:
| Q |
151 |
ttataattttgtatgaacaaaccaaaacacatcactaagcaaaaacaataatcaaaattaatttgtttttctaaatgtgcatgaaggtgacgcggtcctc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13645275 |
ttataattttgtatgaacaaaccaaaacacatcactaagcaaaaaaaataatcaaaattaatttgtttttccaaatgtgcatgaaggtgacgcggtcctc |
13645176 |
T |
|
| Q |
251 |
ctgaaaggctgtcttataaatacaatgacaagcgtaaacaacactgaaa-taaaaaataaacatatcgaga |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||| |
|
|
| T |
13645175 |
ctgaaaggctgtcttataaatacaatgacaagcgtaaacaacactgaaacgaagaaaaaaacatatcgaga |
13645105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 13645438 - 13645336
Alignment:
| Q |
19 |
aacatgctgttaagagtaaacaaaagatcaaatgtatgtagtctata-nnnnnnnggtgaatgtatgtagtctatgtttatttttggtgaatatatgtag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13645438 |
aacatgctgttaagagtaaacaaaagatcaaatgtatgtagtctatattttttttggtgaatgtatgtagtctatgtttatttttggtgaatgtatgtag |
13645339 |
T |
|
| Q |
118 |
tct |
120 |
Q |
| |
|
||| |
|
|
| T |
13645338 |
tct |
13645336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 369
Target Start/End: Complemental strand, 13645080 - 13645033
Alignment:
| Q |
322 |
tcaacttttttgtttcttcttccatcacactaaacattgtttcttctc |
369 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13645080 |
tcaacttttttgtttcttcttccttcacactaaacattgtttcttctc |
13645033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University