View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_high_33 (Length: 298)
Name: NF15718_high_33
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 2426759 - 2427039
Alignment:
| Q |
1 |
gtactgctaccttgcggaaatttttcatcaattttccatggcttcaaatcttccataatccgtggcgactcagaatcctcaaagatagtaggtaaaccag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426759 |
gtactgctaccttgctgaaatttttcatcaattttccatggcttcaaatcttccataatccgtggcgactcagaatcctcaaagatagtaggtaaaccag |
2426858 |
T |
 |
| Q |
101 |
tagctttaaccttcttcaattccatcttcagctgttctatcaaatcctgatgctcccaaagtgtgtcgaaccggttggactcgtcgagatcaaaagctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
2426859 |
tagctttaaccttcttcaattccatcttcagctgttctatcaaatcctgatgctcccaaagtgtgtcgaaccggttggactcatcgagatcaaaagctgt |
2426958 |
T |
 |
| Q |
201 |
taaactcttcgaattttgtttcagagattcttcctgtctgatttcttcttctaattttccaagctcattcattatatcttc |
281 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426959 |
taaactcttcgaattttgtttcagcgattcttcctgtctgatttcttcttctaattttccaagctcattcattatatcttc |
2427039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University