View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_high_40 (Length: 268)
Name: NF15718_high_40
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 41037933 - 41038168
Alignment:
| Q |
18 |
tttgcttgggatgaccatgtatgttttctatcaccttaattttatgaacaaaatttagactctaaattttgtctatagattaagtaattaattaaataat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41037933 |
tttgcttgggatgaccatgtatgttttctatcaccttaattttatgaacaaaatttagactctaaattttgtctatagattaaataattaattaaataat |
41038032 |
T |
|
| Q |
118 |
gctgcattattaatgatattttgcagtggatattctgggttggaccatttattggagctgctcttgctgctgtgtatcaccagattgtcatccgagccat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41038033 |
gctgcattattaatgatattttgcagtggatattctgggttggaccatttattggagctgctcttgctgctgtgtatcaccagattgtcatccgagccat |
41038132 |
T |
|
| Q |
218 |
tcctttcaagacaaggacctgaggctcttatctgtg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41038133 |
tcctttcaagacaaggacctgaggctcttatctgtg |
41038168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 200 - 253
Target Start/End: Complemental strand, 32570357 - 32570304
Alignment:
| Q |
200 |
gattgtcatccgagccattcctttcaagacaaggacctgaggctcttatctgtg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32570357 |
gattgtcatccgagccattcctttcaagacaaggacctgaggctcttatctgtg |
32570304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 200 - 253
Target Start/End: Complemental strand, 1615870 - 1615817
Alignment:
| Q |
200 |
gattgtcatccgagccattcctttcaagacaaggacctgaggctcttatctgtg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1615870 |
gattgtcatccgagccattcctttcaagacaaggacctgaggctcttatctgtg |
1615817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 141 - 233
Target Start/End: Complemental strand, 2649071 - 2648979
Alignment:
| Q |
141 |
cagtggatattctgggttggaccatttattggagctgctcttgctgctgtgtatcaccagattgtcatccgagccattcctttcaagacaagg |
233 |
Q |
| |
|
|||||||| |||||||||||||| || ||||||||||| ||||||||| | ||||||||||| || |||||||| |||||||||||| ||||| |
|
|
| T |
2649071 |
cagtggattttctgggttggacctttcattggagctgcacttgctgctttatatcaccagatagtgatccgagcaattcctttcaaggcaagg |
2648979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 138 - 184
Target Start/End: Complemental strand, 35229746 - 35229700
Alignment:
| Q |
138 |
ttgcagtggatattctgggttggaccatttattggagctgctcttgc |
184 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
35229746 |
ttgcagtggatcttctgggtgggaccatttattggagcagctcttgc |
35229700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 232
Target Start/End: Complemental strand, 31459392 - 31459299
Alignment:
| Q |
139 |
tgcagtggatattctgggttggaccatttattggagctgctcttgctgctgtgtatcac-cagattgtcatccgagccattcctttcaagacaag |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||| || || ||||| ||| | || ||| ||| |||| ||| ||||||||||||||||| |||| |
|
|
| T |
31459392 |
tgcagtggattttctgggttggaccattcattggtgcagcacttgcagctctttaccacacag-ttgtgatcagagccattcctttcaagtcaag |
31459299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University