View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_high_44 (Length: 250)
Name: NF15718_high_44
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_high_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 21 - 227
Target Start/End: Original strand, 39249237 - 39249443
Alignment:
| Q |
21 |
taggcaggatgaacattttagtcttgatgttgttcagctggaagatggtaatgatttgttagaaccagctctgaggagatgtcatgataagaagaggttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39249237 |
taggcaggatgaacattttagtcttgatgttgttcagctggaagatggtaatgatttgttagaaccagctctgaggagatgtgatgataagaagaggttg |
39249336 |
T |
|
| Q |
121 |
gaaaatggtgttaagaatggactggcttcacggtcgaagcaagagatgcgggggattaagaggaagcttgagggctaccttgaaacggtgaggtcattgg |
220 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39249337 |
gagaatggtgttaagaatggactggcttcacggtcgaagcaagagatgcgggggattaagaggaagcttgagggctaccttgaaacggtgaggtcattgg |
39249436 |
T |
|
| Q |
221 |
tgattag |
227 |
Q |
| |
|
||||||| |
|
|
| T |
39249437 |
tgattag |
39249443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 28 - 227
Target Start/End: Original strand, 39260337 - 39260533
Alignment:
| Q |
28 |
gatgaacattttagtcttgatgttgttcagctggaagatggtaatgatttgttagaaccagctctgaggagatgtcatgataagaagaggttggaaaatg |
127 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||| ||||||||||| |||||| |||| |
|
|
| T |
39260337 |
gatgagcattttagtcttgatgttgttcagctggaagatggtaatgatttgtttgaaccagcttt---aagatgtaatgataagaaggagttggagaatg |
39260433 |
T |
|
| Q |
128 |
gtgttaagaatggactggcttcacggtcgaagcaagagatgcgggggattaagaggaagcttgagggctaccttgaaacggtgaggtcattggtgattag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
39260434 |
gtgttaagaatggactggcttcacggtcgaagcaagagatgcgggagattaagaggaagcttgagggcgaccttgaaacggtgaggtctttggtgattag |
39260533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University