View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_high_50 (Length: 222)
Name: NF15718_high_50
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 2426663 - 2426725
Alignment:
| Q |
145 |
cacttacctaaagcatacatcttttggtaattcaagatatcaaattttctcattctttctctg |
207 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426663 |
cacttacctaaagcatacatcttttgataattcaagatatcaaattttctcattctttctctg |
2426725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University