View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_high_53 (Length: 206)
Name: NF15718_high_53
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 21294165 - 21293984
Alignment:
| Q |
17 |
aggggaccgtacaattggtcattttctccagattaataatgaagccccataagaaactgataataataata---gtcgctaatatctaatatcataaata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21294165 |
aggggaccgtacaattggtcattttctccagattaata-tgaagccccataagaaactgataataataataatagtcgctaatatctaatatcataaata |
21294067 |
T |
 |
| Q |
114 |
tagtattgtcggtacaacaaaatgatagaataagcaacatttaaggttcagtttaggctcacatctagctacagatgatgtcc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21294066 |
tagtattgtcggtacaacaaaatgatagaataagcaacatttaaggttcagtttaggctcacatctagctacagatgatgtcc |
21293984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University