View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_26 (Length: 370)
Name: NF15718_low_26
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 40 - 220
Target Start/End: Original strand, 31935716 - 31935897
Alignment:
| Q |
40 |
atcagataacttgatcaacttaaataacttgaatatgttttcaatgtatggtttgatggtctcataaaaacaattattatatctcagaaatcaaattgat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31935716 |
atcagataacttgatcaacttaaataacttgaatatgttttcaatgtatggttcgatggtctcataaaaacaattat-atatctcagaaatcaaattgat |
31935814 |
T |
 |
| Q |
140 |
gaagtaccaaaggtatactgtctataccaacttctcagcttgatttacatcagtttttatt--acacacaccaatatgtgtat |
220 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31935815 |
gaagtaccaaaggtataccgtctataccaacttctcagcttgatttacatcagtttttattacacacacaccaatatgtgtat |
31935897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 241 - 278
Target Start/End: Original strand, 31935914 - 31935951
Alignment:
| Q |
241 |
ggtattcatctttaatatgaatcatttatgttagaaca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935914 |
ggtattcatctttaatatgaatcatttatgttagaaca |
31935951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University