View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_27 (Length: 361)
Name: NF15718_low_27
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 49 - 226
Target Start/End: Original strand, 34725349 - 34725519
Alignment:
| Q |
49 |
ttatactccaaggatgattggagcactttttaaaattgatttgaacattgcagagtatatcatcccttggaataagagccattgcattaattgacttgta |
148 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
34725349 |
ttatactccaaggatgattggaccactttttaaaattgatttgaacattgcagagtatatc---ccttggaataagagccattgcatt----gacttgta |
34725441 |
T |
 |
| Q |
149 |
ctattgtttaagatcaactgtttaaatatgtgtcttgttgctagaaaattatcttcacaatcttcagagtatatcctt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34725442 |
ctattgtttaagatcaactgtttaaatatgtgtcttgttgctagaaaattatcttcacaatcttcagagtatatcctt |
34725519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 34725275 - 34725314
Alignment:
| Q |
11 |
atttcttgtgcacttcttgagtatgaatatttctgttgtt |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34725275 |
atttattgtgcacttcttgagtatgaatatttcttttgtt |
34725314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University