View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_49 (Length: 268)
Name: NF15718_low_49
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 2 - 252
Target Start/End: Original strand, 9003612 - 9003862
Alignment:
| Q |
2 |
ttaggtgtcgaatatgattggtgatggtggtcaagaagaaggatgggtggtgtgtaggatattcaagaagaagaatcatctcaaaaccctagacagccct |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9003612 |
ttaggtgtcgaatatgattggtgatggtggtcaagaagaaggatgggtggtgtgtaggatattcaagaagaagaatcatctcaaaaccctagacagccct |
9003711 |
T |
 |
| Q |
102 |
tctggagagggaagaagaagccatcacttgtatgatacttgtgatgaaggagctttggagcaaatacttcaacaaatgggaaggggttgcaaggaagaga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9003712 |
tctggagagggaagaagaagccatcacttgtatgatacttgtgatgaaggagctttggagcaaatacttcaacaaatgggaaggggttgcaaggaagaga |
9003811 |
T |
 |
| Q |
202 |
attatgaagcaaattacaataataattatggaaggtttgctaggccctttg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9003812 |
attatgaagcaaattacaataataattatggaaggtttgctaggccttttg |
9003862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University