View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_50 (Length: 268)
Name: NF15718_low_50
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 3346176 - 3345936
Alignment:
| Q |
18 |
aaccacatggttaaaca---gtaagattttgttttttgg---aagactaaacaatcgttagatgataagcaccactacatgcatgttactataaaggaga |
111 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
3346176 |
aaccacatggttaaacaattgtaagattttgtttttttttttaagactaaacaatcgttagatgataagcactactacatg----ttactataaaggaga |
3346081 |
T |
|
| Q |
112 |
taatgtggaaggaattaatttacaatattttttgttgccattataaaataatcattgtgggatgacgtctcttcaaagaaaatacttgatttctcaaaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3346080 |
taatgtggaaggaattaatttacaatattttttgttgccattataaaataatcattgtgggatgacgtctcttcaaagaaaatacttgatttctcaaaca |
3345981 |
T |
|
| Q |
212 |
aatggaaaaagtaataatcaataaataaaaccaattgtgttctct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3345980 |
aatggaaaaagtaataatcaataaataaaaccaattgtgttctct |
3345936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University