View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_58 (Length: 243)
Name: NF15718_low_58
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 13885435 - 13885224
Alignment:
| Q |
17 |
agaaggaagatgtgaaggtgtttgttgatcgcaacattctcaagattgaggatacttttccgggtcgcaatcgattcagtggaacactcgacttggctaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13885435 |
agaaggaagatgtgaaggtgtttgttgatcgcaacattctcaagattgaggatacttttccgggtcgcaatcgattcagtggaacactcgacttggctaa |
13885336 |
T |
 |
| Q |
117 |
gaagaactgtgacggtcttcacacaacagccaagttcgagaacaacgttcttcaaatcgtgattcccaagaagaacaaggatgaagatgaagttgatctc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13885335 |
gaagaactgtgacggtcttcacacaacagccaagttcgagaacaatgttcttgaaatcgtgattcccaagaagaacaaggatgaagatgaagttgatctc |
13885236 |
T |
 |
| Q |
217 |
atcgttcttcat |
228 |
Q |
| |
|
| |||||||||| |
|
|
| T |
13885235 |
accgttcttcat |
13885224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University