View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_59 (Length: 242)
Name: NF15718_low_59
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_59 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 234
Target Start/End: Original strand, 29480458 - 29480671
Alignment:
| Q |
21 |
tagtttatttttcttcataataaaaaatctcatttatttaagggaactcaaaagaggtattggatgagcattttgaagtgtttagacaaagttttcaaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29480458 |
tagtttatttttcttcataataaaaaatctcatttatttaagggaactcaaaagaggtattggatgagcattttgaagtgtttagacaaaattttcaaat |
29480557 |
T |
 |
| Q |
121 |
caattacatgttatattaatgatttaaaattaaaaatacattaatcataaagattgtcccatcgttctctataaaatcactctttcaaataaaggtgaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29480558 |
caattacatgttatattaatgatttaaaattaaaaatacattaatcataaagatcgtcccatcgttctctataaaatcactctatcaaataaagctgaat |
29480657 |
T |
 |
| Q |
221 |
gtttcttctctctc |
234 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29480658 |
gtttcttctctctc |
29480671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University