View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_61 (Length: 240)
Name: NF15718_low_61
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 51677107 - 51677319
Alignment:
| Q |
19 |
aatccaccctttttgtagtcctgcctcatcaattgatagggaaataattgggataggaggtaaaactttttaaagaaaggcgtatgacactgtaattcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51677107 |
aatccaccctttttgtagtcctgcctcatcaattgatagggaaataattgggatgggaggtaaaactttttaaagaaaggcgtatgacactgtaattcta |
51677206 |
T |
 |
| Q |
119 |
taattgctaggtggtaaactgtcctatatgatggtttatgataaagaatttataaacttcttagcaaaaaataaataaatacaatatattggaaatcaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51677207 |
taattgctaggtggtaaactgtcctat---atggtttatgataaagaatttataaacttcttagcaaaaaataaataaatacaatatattggaaatcaat |
51677303 |
T |
 |
| Q |
219 |
tgtgtgtgatgatgtc |
234 |
Q |
| |
|
||||| |||| ||||| |
|
|
| T |
51677304 |
tgtgtctgattatgtc |
51677319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University