View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15718_low_65 (Length: 212)

Name: NF15718_low_65
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15718_low_65
NF15718_low_65
[»] chr6 (1 HSPs)
chr6 (96-201)||(33481391-33481496)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 96 - 201
Target Start/End: Original strand, 33481391 - 33481496
Alignment:
96 tttctatcatttggaatactgcgtaattttcttgatatgcaataatttttcaatgctcatgttatttttggatttcactttatgtggctctctacttcat 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33481391 tttctatcatttggaatactgcgtaattttcttgatatgcaataatttttcaatgctcatgttatttttggatttcactttatgtggctctctacttcat 33481490  T
196 ctcact 201  Q
    ||||||    
33481491 ctcact 33481496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University