View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15718_low_65 (Length: 212)
Name: NF15718_low_65
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15718_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 96 - 201
Target Start/End: Original strand, 33481391 - 33481496
Alignment:
| Q |
96 |
tttctatcatttggaatactgcgtaattttcttgatatgcaataatttttcaatgctcatgttatttttggatttcactttatgtggctctctacttcat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33481391 |
tttctatcatttggaatactgcgtaattttcttgatatgcaataatttttcaatgctcatgttatttttggatttcactttatgtggctctctacttcat |
33481490 |
T |
|
| Q |
196 |
ctcact |
201 |
Q |
| |
|
|||||| |
|
|
| T |
33481491 |
ctcact |
33481496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University