View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15718_low_69 (Length: 201)

Name: NF15718_low_69
Description: NF15718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15718_low_69
NF15718_low_69
[»] chr7 (1 HSPs)
chr7 (1-184)||(47760060-47760243)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 47760243 - 47760060
Alignment:
1 agagtgttcagattcacttttttctgtttccattacttgtggaaaaccagtttcaatagaagaaaatgaagttaacagtaatcatgcaaaagatgaatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47760243 agagtgttcagattcacttttttctgtttccattacttgtggaaaaccagtttcaatagaagaaaatgaagttaacagtaatcatgcaaaagatgaatca 47760144  T
101 aagagtgaagagcaaccaaatgaagccaaagatttggatgaaaaaacaagacagatgaatcaatctaaccttgatctttataat 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
47760143 aagagtgaagagcaaccaaatgaagccaaagatttggatgaaaaaacaagaccgatgaatcaatctaaccttgatctttataat 47760060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University