View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15719_high_18 (Length: 340)
Name: NF15719_high_18
Description: NF15719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15719_high_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 15 - 340
Target Start/End: Original strand, 171657 - 171982
Alignment:
| Q |
15 |
cagacccgacccagcaaacccgttgagcccaatacactgacctaataactccctccctcatcttcttcgccagaagtttttcctttcccactcgccaccg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171657 |
cagacccgacccagcaaacccgttgagcccaatacactaacctaataactccctccctcatcttcttcgccagaagtttttcctttcccactcgccaccg |
171756 |
T |
|
| Q |
115 |
ttgcgccaccctctccactcgttgattccttcgccgtttgcgttcaccaccgtcnnnnnnntacgaaactgagtgtggtcgtatctgtttcacaattgca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171757 |
ttgcgccaccctctccactcgttgattccttcgccgtttgcgttcaccaccgtcaaaaaaatacgaaactgagtgtggtcgtatctgtttcacaattgca |
171856 |
T |
|
| Q |
215 |
ttacagaatgagtgttccaaatgctgctgcaacggaggatttgtcctctgaaatggaagtcgatgcgtttcgacgcctttttccgcttcgatacttcgaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171857 |
ttacagaatgagtgttccaaatgctgctgcaacggaggatttgtcctctgaaatggaagtcgatgcgtttcgacgcctttttccgcttcgatacttcgaa |
171956 |
T |
|
| Q |
315 |
cgtcatcttgctgaatccattcgttc |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
171957 |
cgtcatcttgctgaatccattcgttc |
171982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University