View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15719_high_19 (Length: 338)
Name: NF15719_high_19
Description: NF15719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15719_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 35508179 - 35507987
Alignment:
| Q |
20 |
atggggggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggttgttcgcggcggttctccggcggtgcttcacttctgggcgtcctggtgtg |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35508179 |
atgggtggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggtggttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg |
35508080 |
T |
 |
| Q |
120 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508079 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
35507987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 279 - 330
Target Start/End: Complemental strand, 35507920 - 35507869
Alignment:
| Q |
279 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgct |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507920 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgct |
35507869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University